Improved quantitative real-time PCR assays for enumeration of harmful algal species in field samples using an exogenous DNA reference standard

Quantitative real-time PCR (QPCR) is a powerful and sensitive method for quantitative detection of microorganisms. Application of this methodology for enumeration of harmful algal bloom (HAB) species has the potential to revolutionize our approach to HAB research, making it possible to identify correlations between cell abundances and factors that regulate bloom dynamics. Its application to ecological studies, however, has produced mixed results. QPCR assays typically rely on the generation of standard curves from plasmids or laboratory cultures that may be unrealistic when compared to amplification of DNA extracted from field samples. In addition, existing methods often fail to incorporate controls to assess variability in extraction and amplification efficiencies, or include controls that are sequence-specific and preclude the investigation of multiple species. Here, we describe the development and rigorous analysis of QPCR assays for two HAB species, Chattonella subsalsa and Heterosigma akashiwo, in which we introduce a known concentration of exogenous DNA plasmid into the extraction buffer as a reference standard. Since the target DNA is extracted in the presence of the reference standard, inherent variability in extraction and amplification efficiencies affect both target and standard equally. Furthermore, the reference standard is applicable to QPCR analysis of any microbial species. Using environmental bloom samples as calibrators, we evaluated the accuracy of the comparative Ct method for enumeration of target species in several field samples. Our investigation demonstrates that the comparative Ct method with an exogenous DNA reference standard provides both accurate and reproducible quantification of HAB species in environmental samples. *E-mail: [email protected] Acknowledgments We thank Yaohong Zhang (University of Delaware) for technical assistance. Lauren Salvitti (Goucher College) and Brian Keuski (University of Delaware) also assisted with sample processing and primer development. We are grateful to the Inland Bays Citizen Monitoring Program (coordinated by EBW) for assistance with sample collection and cell counts. This research was funded by grants from USA-EPA STAR-ECOHAB (to DAH, KJC, SCC, and MAD), NOAA MERHAB (to SCC and KJC), and from the Center for the Inland Bays (to EBW). Limnol. Oceanogr.: Methods 3, 2005, 381–391 © 2005, by the American Society of Limnology and Oceanography, Inc. LIMNOLOGY and OCEANOGRAPHY: METHODS significantly in quantity and quality, affecting the outcome of quantitative PCR by several-fold (Bostrom et al. 2004). Coprecipitation of compounds that inhibit PCR also confounds molecular analyses of environmental samples (Stults et al. 2001; Tebbe and Vahjen 1993; Wilson 1997) by producing false negative results. The relative QPCR approach, in which the target gene is normalized to a reference standard, provides a more accurate assessment of cell abundances. Methods have been described, for example, in which cells are spiked into samples (Brinkman et al. 2003; Lebuhn et al. 2004), reducing error due to inherent differences in extraction or amplification efficiencies. These methods rely on the assumption that the lysing efficiency of spiked cells is the same as target cells for every sample. In addition, samples are spiked independently, potentially introducing another source of error. Other methods incorporate reference standards that are sequence-specific and preclude the QPCR quantification of multiple and diverse targets from the same field sample. Widada et al. (2002), for example, spiked cells containing an artificial construct competitor DNA directly into the extraction buffer for use in competitive QPCR. Analysis of multiple species, however, requires that a separate construct be prepared and calibrated for each species under investigation. Here, we describe the development of relative QPCR assays for quantification of two Raphidophyte species, Chattonella subsalsa and Heterosigma akashiwo. These organisms have gained recognition as fish-killing phytoplankton, causing massive mortalities of fish and resulting in millions of dollars in damage to the aquaculture industry (Black et al. 1991; Horner 1999; Yang et al. 1995). In addition, brevetoxin-like compounds produced by Raphidophytes (Haque and Onoue 2002; Khan et al. 1996a, 1996b, 1997) pose a threat to higher trophic levels (including wildlife and humans) since they can potentially be concentrated during food web transfer (Ishida et al. 2004; Plakas et al. 2004; Stommel and Watters 2004; Woofter et al. 2005). Conventional microscopic methods for identifying and estimating the abundance of Raphidophyte species in complex environmental samples are time-consuming and often lack the sensitivity required for background level detection. Some species, such as Heterosigma akashiwo, can also be pleomorphic, making them difficult to identify in complex mixtures. Further, Raphidophytes are very fragile, and cell counts of environmental samples prepared with standard phytoplankton fixation methods may be unreliable (Throndsen 1997). Our objectives were to develop QPCR methods for rapid, sensitive, and accurate identification and enumeration of Raphidophytes in environmental water samples. To eliminate errors due to extraction and amplification efficiencies, a known concentration of exogenous plasmid DNA was introduced into the extraction buffer as a reference standard. We determined the sensitivity of the assay and range of detection for each of the target genes. Intra-sample variability (precision) was evaluated for environmental samples with both high and low abundances of the target species. Finally, we evaluated the accuracy of the comparative Ct method (Livak and Schmittgen 2001) using an environmentally relevant calibrator sample for QPCR quantification of Chattonella subsalsa and Heterosigma akashiwo in several field samples. The calibrator consisted of DNA extracted from field samples during blooms of H. akashiwo and C. subsalsa. Accurate cell counts of each target species in the calibrator samples provided a comparative basis for calculating cell abundances in unknown field samples. The approach described here may be applied to development of QPCR assays of other microbial species in complex environmental samples. Materials and procedures Determination of 18S rDNA sequences—Delaware Inland Bays (DIB) isolates Chattonella subsalsa (CCMP 2191) and Heterosigma akashiwo (CCMP 2393) were cultured at 24°C in f/2 growth medium (Guillard 1975). Cells were collected by centrifugation and lysed in 0.7 mL CTAB buffer (100 mM Tris-HCl [pH 8], 1.4 M NaCl, 20 mM EDTA, 2% [w/v] cetyltrimethylammonium bromide [CTAB], 0.4% [v/v] β-mercaptoethanol, 1% [w/v] polyvinylpyrollidone; [Dempster et al. 1999]). DNA was extracted as in Coyne et al. (2001). The region spanning the 18S through ITS2 region of the rDNA gene was amplified by PCR in a 20-μL reaction volume containing 0.2 mM dNTPs, 0.5 μM Euk A (5′ AACCTGGTTGATCCTGCCAGT 3′) (Medlin et al. 1988), 0.5 μM Raph ITS R (5′ YGCCAGGTGCGTTCGAA 3′), 2.5 mM MgCl2, 1X Taq polymerase buffer (Sigma Chem. Co.), and 0.5 units Jump-Start Taq Polymerase (Sigma Chem. Co.). The reaction consisted of 35 cycles of 30 s at 94°C, 30 s at 56°C, and 2.5 min at 72°C, followed by a 5-min extension at 72°C. PCR products were cloned into pCR4 TOPO plasmid vector (Invitrogen) and bi-directionally sequenced using Big Dye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystem). Quantitative real-time PCR primers and probes—Primer and probe sites for Chattonella subsalsa and Heterosigma akashiwo were identified by aligning the 18S rDNA sequences of the DIB isolates to sequences of closely related species in GenBank (www.ncbi.nlm.nih.gov) using Clustal (Thompson et al. 1994) in the Genetic Data Environment (Smith et al. 1994). Each primer pair was designed to amplify approximately 350 bp of the 18S rDNA gene (Table 1). Taqman probes were designed using Primer Express software (Applied Biosystems). The probes were synthesized with a 6-FAM (6-carboxyfluorescein) reporter dye at the 5′ end and a TAMRA (6-carboxytetramethylrhodamine) quencher molecule at the 3′ end. Primer and probe concentrations were optimized for quantitative real-time PCR on an ABI Prism 7700 Sequence Detection System (Applied Biosystems) using cloned plasmids containing the 18S rDNA sequence for Chattonella subsalsa and Heterosigma akashiwo as template. Optimized reaction conditions for each target species consisted of a 25-μL Coyne et al. Improved QPCR quantification of algal species